Top » Catalog » R1b » A99

$18.00

A99
[A99]

A99
hg38 Position: ChrY:8807409..8807409
Ancestral: T
Derived: C
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i6~
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A99_F CAAGAAGCAAATAAAATTGCCG
Reverse Primer: A99_R GTTTGGCTTCAACGACAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2226
1 x A2267
1 x A1056
1 x A746
1 x A792
1 x A1507
1 x A1309
1 x A986
1 x A1302
1 x A450
1 x A715
1 x A2265
1 x A1540
1 x A963
1 x A19
1 x A352
1 x A1324
1 x A2161
1 x A277
1 x A220
1 x A153
1 x A2255
$396.00
Haplogroup Info
Other products
Currencies