Top » Catalog » R1b » A99

$18.00

A99
[A99]

A99
hg38 Position: ChrY:8807409..8807409
Ancestral: T
Derived: C
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i6~
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A99_F CAAGAAGCAAATAAAATTGCCG
Reverse Primer: A99_R GTTTGGCTTCAACGACAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies