Top » Catalog » R1b » A584

$18.00

A584
[A584]

A584
hg38 Position: ChrY:3020755..3020755
Ancestral: A
Derived: G
Reference: Gerald Lyons (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A584v2_F GCTGCTTATGACCATCCCAG
Reverse Primer: A584v2_R GTGGCGCGATCTCCAATT
Reviews

Customers who bought this product also purchased
S3539
S3539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1059
1 x A230
1 x A2234
1 x A431
1 x A521
1 x A741
1 x A854
1 x A150
1 x A722
1 x A355
1 x A2191
1 x A524
1 x A723
1 x A884
$252.00
Haplogroup Info
Other products
Currencies