Top » Catalog » R1b » A603

$18.00

A603
[A603]

A603
hg38 Position: ChrY:13499657..13499657
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A603_F CATATGTTGAGGGGGCTGAG
Reverse Primer: A603_R ATGCCCAGCAAAGTACTTCC
Reviews

Customers who bought this product also purchased
A514
A514
A510
A510
A513
A513
A511
A511
A604
A604
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies