Top » Catalog » R1b » A604

$18.00

A604
[A604]

A604
hg38 Position: ChrY:19262880..19262880
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A604_F CAAGTTTTGGGGCTCTTGTC
Reverse Primer: A604_R CTGCTTATTCCTGTGAATGAACC
Reviews

Customers who bought this product also purchased
A514
A514
A510
A510
A513
A513
A511
A511
A603
A603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies