Top » Catalog » R1b » A559

$18.00

A559
[A559]

A559
hg38 Position: ChrY:7117028..7117028
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A559_F TGACTTCCCACAACATGTGTG
Reverse Primer: A559_R TCCATGAAAGTACTGGATGGC
Reviews

Customers who bought this product also purchased
A561
A561
A570
A570
A560
A560
A569
A569
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A567
A567
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A174
$18.00
Haplogroup Info
Other products
Currencies