Top » Catalog » R1b » A560

$18.00

A560
[A560]

A560
hg38 Position: ChrY:8371794..8371794
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b2
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A560_F CATGCACCCTACCCAAGAG
Reverse Primer: A560_R CATAGAAAATGTGTGAGGTGTTCAC
Reviews (1)

Customers who bought this product also purchased
FGC22185
FGC22185
FGC22184
FGC22184
FGC22183
FGC22183
FGC22182
FGC22182
FGC22179
FGC22179
FGC22189
FGC22189
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies