Top » Catalog » R1b » A565

$18.00

A565
[A565]

A565
hg38 Position: ChrY:15396972..15396972
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A565_F CTGAAGCTTTTACATCTTTGTTATATGTG
Reverse Primer: A565_R AGGCATGTGCATGGAAGC
Reviews (1)

Customers who bought this product also purchased
FGC22242
FGC22242
DNA Sample Kit
DNA Sample Kit
A560
A560
A570
A570
A559
A559
A569
A569
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A555
$18.00
Haplogroup Info
Other products
Currencies