Top » Catalog » R1b » A566

$18.00

A566
[A566]

A566
hg38 Position: ChrY:16314401..16314401
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A566_F GAGGTGGGACAGTTATTCAAATC
Reverse Primer: A566_R TCTATAACCCAATGAATCAGCACTAC
Reviews

Customers who bought this product also purchased
A573
A573
A561
A561
A571
A571
A560
A560
A570
A570
A559
A559
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A470
$18.00
Haplogroup Info
Other products
Currencies