Top » Catalog » R1b » A567

$18.00

A567
[A567]

A567
hg38 Position: ChrY:17056410..17056410
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A567_F TGGCACAATGTGATCCAAAC
Reverse Primer: A567_R CTAATTTGCATTCTCACAAGCTG
Reviews

Customers who bought this product also purchased
A560
A560
A570
A570
A559
A559
A569
A569
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A566
A566
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A517
$18.00
Haplogroup Info
Other products
Currencies