Top » Catalog » R1b » A567

$18.00

A567
[A567]

A567
hg38 Position: ChrY:17056410..17056410
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A567_F TGGCACAATGTGATCCAAAC
Reverse Primer: A567_R CTAATTTGCATTCTCACAAGCTG
Reviews

Customers who bought this product also purchased
A561
A561
A571
A571
A560
A560
A570
A570
A559
A559
A569
A569
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2270
1 x A1299
1 x A1779
1 x A578
1 x A733
1 x A322
1 x A585
1 x A446
1 x A1070
1 x A256
$180.00
Haplogroup Info
Other products
Currencies