Top » Catalog » R1b » A570

$18.00

A570
[A570]

A570
hg38 Position: ChrY:19356711..19356711
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A570_F AAGTAGCCTGAATAGCCAAAGTAGTC
Reverse Primer: A570_R TTTTACCTGTGGTTTTGAGGTG
Reviews

Customers who bought this product also purchased
FGC22242
FGC22242
A561
A561
A571
A571
A560
A560
A569
A569
A559
A559
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1161
1 x A1243
$36.00
Haplogroup Info
Other products
Currencies