Top » Catalog » R1b » A571

$18.00

A571
[A571]

A571
hg38 Position: ChrY:19827657..19827657
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1a2b
Comments: downstream from U106 > FGC3861 > FGC14877
Forward Primer: A571_F TCACCACTGGGTATACATTTATGG
Reverse Primer: A571_R TTAAAAGCTGGTATCTTTGCTTTTC
Reviews

Customers who bought this product also purchased
A569
A569
A559
A559
A567
A567
R1b-FGC14877 downstream
R1b-FGC14877 downstream
A566
A566
A565
A565
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A761
1 x A142
1 x A654
1 x A2117
1 x A48
1 x A961
$108.00
Haplogroup Info
Other products
Currencies