Top » Catalog » R1b » A646

$18.00

A646
[A646]

A646
hg38 Position: ChrY:7418069..7418069
Ancestral: C
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A646_F TTTCTTAGGGAATCACATGGATG
Reverse Primer: A646_R AGGGGAATTGAGGAATCACTG
Reviews

Customers who bought this product also purchased
A647
A647
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A639
$18.00
Haplogroup Info
Other products
Currencies