Top » Catalog » R1b » A10891

$18.00

A10891
[A10891]

A10891
hg38 Position: ChrY:7284483..7284483
Ancestral: G
Derived: A
Reference: James J Treacy (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of A557
Forward Primer: A10891_F GGTCTTGCAGAGCATGGTG
Reverse Primer: A10891_R GAGGCCTTAGGAGGAACCAG
Reviews

Customers who bought this product also purchased
YFS1390488
YFS1390488
A10887
A10887
A10893
A10893
YFS1390487
YFS1390487
R1b-A557 Treacy Panel
R1b-A557 Treacy Panel
A10892
A10892
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A7111
1 x A873
1 x A9877
1 x A5876
1 x A10110
1 x A862
1 x A814
1 x A865
1 x A7729
1 x A824
1 x A417
1 x A7358
1 x A10030
1 x A7389
1 x A11113
1 x A9363
1 x A6699
1 x A1514
1 x A7407
1 x A1221
1 x A7720
1 x A8462
1 x A5861
1 x A9405
1 x A9061
1 x A7718
1 x A2423
1 x A10032
1 x A9534
1 x A8740
1 x A8741
1 x A10112
1 x A7723
1 x A5913
1 x A1144
1 x A10741
1 x A5914
1 x A9404
1 x A7395
1 x A5860
1 x A8689
1 x A10758
1 x A7719
1 x A9403
1 x A427
1 x A10026
1 x A7724
1 x A11098
1 x A10035
1 x A812
1 x A2230
1 x A11097
1 x A10036
1 x A871
1 x A866
1 x A10513
1 x A1143
1 x A2329
1 x A6696
1 x A1146
1 x A2512
1 x A10959
1 x A7725
1 x A8691
1 x A5859
1 x A7403
1 x A8742
1 x A10514
1 x A10031
1 x A11114
1 x A10757
1 x A1140
1 x A10727
$1,314.00
Haplogroup Info
Other products
Currencies