Top » Catalog » R1b » A10316

$17.50

A10316
[A10316]

A10316
HG19 Position: ChrY:7509598..7509599
Ancestral: ins
Derived: del
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF49 > S661 > ZS8379
Forward Primer: A10316_F CACTGATCCTCAGTCACAGGG
Reverse Primer: A10316_R GGGGAGAACAATAAAGCTCCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies