Top » Catalog » R1b » ZP144

$18.00

ZP144
[ZP144]

ZP144
hg38 Position: ChrY:7240118..7240118
Ancestral: C
Derived: G
Reference: Peter Op den Velde Boots (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of S19726
Forward Primer: ZP144_F GCCCAGTTCCTCTTGTCTCC
Reverse Primer: ZP144_R CACTCTGTCACTCAGGCTGG
Reviews

Customers who bought this product also purchased
ZP30
ZP30
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies