Top » Catalog » R1b » A11895

$18.00

A11895
[A11895]

A11895
hg38 Position: ChrY:13315785..13315785
Ancestral: A
Derived: C
Reference: Susan Milligan (2016)
ISOGG Haplogroup: R1b
Comments: Downstream M222 > S660
Forward Primer: A11895_F TGGGGAGGAAACTGTAAAAGG
Reverse Primer: A11895_R CCCCAAAAATCTCAAGAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies