Top » Catalog » R1b » A11905

$18.00

A11905
[A11905]

A11905
hg38 Position: ChrY:8379036..8379036
Ancestral: T
Derived: G
Reference: Susan Milligan (2016)
ISOGG Haplogroup: R1b
Comments: Downstream M222 > S660
Forward Primer: A11905_F TCACCTTTTCTGCTGGGTTC
Reverse Primer: A11905_R TTGGGCCTATCGTTTAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies