Top » Catalog » R1b » A11977

$18.00

A11977
[A11977]

A11977
hg38 Position: ChrY:12902464..12902464
Ancestral: G
Derived: A
Reference: Jerry Garrison (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. S12035. Below U106 > Z8 > Z338
Forward Primer: A11977_F TTCTTAGGCTGGTTGCAGTG
Reverse Primer: A11977_R AACAGGGTTGCAAACGGTAG
Reviews

Customers who bought this product also purchased
A11978
A11978
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10672
1 x A11683
1 x A10680
1 x A12494
1 x A11629
$90.00
Haplogroup Info
Other products
Currencies