Top » Catalog » R1b » A11986

$18.00

A11986
[A11986]

A11986
hg38 Position: ChrY:14931476..14931476
Ancestral: A
Derived: G
Reference: Colin Munro (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z251 > Z16943
Forward Primer: A11986_F GTGCTGCCATAAACATGCG
Reverse Primer: A11986_R CATCTCACTGACCATTCCAATG
Reviews

Customers who bought this product also purchased
A11984
A11984
A11987
A11987
A11985
A11985
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies