Top » Catalog » R1b » A12515

$18.00

A12515
[A12515]

A12515
HG19 Position: ChrY:13685706..13685706
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A12515v2_F ATCAGCAAAAGAAAGTATCGTCG
Reverse Primer: A12515v2_R GTCAAATGGTATTTCTGGTTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies