Top » Catalog » R1b » A1710

$18.00

A1710
[A1710]

A1710
hg38 Position: ChrY:13095739..13095739
Ancestral: G
Derived: A
Reference: Terry Barton (2015)
ISOGG Haplogroup: R1b1a2a1a2b1b (not listed)
Comments: Approximately L196
Forward Primer: A1710_F TATGAGAATGGGTGGCACAG
Reverse Primer: A1710_R CCTGCTAACATCCATAAAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies