Top » Catalog » R1b » Z30198

$18.00

Z30198
[Z30198]

Z30198
HG19 Position: ChrY:16007435..16007435
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b1a2a1a2b (not listed)
Comments: Subgrp under Z30194
Forward Primer: Z30198_F GGGTGTGCAAGTCTTTCAGAC
Reverse Primer: Z30198_R GCGGCACTATTCACAATAACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies