Top » Catalog » R1b » A12528

$18.00

A12528
[A12528]

A12528
HG19 Position: ChrY:15958782..15958783
Ancestral: del
Derived: ins
Reference: Roy Keys (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A12528_F AGAAGATCCCTTCCCACTGC
Reverse Primer: A12528_R TTGCTGCCAAACTTCTGAAC
Reviews

Customers who bought this product also purchased
A10616
A10616
A10618
A10618
A10617
A10617
A12527
A12527
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies