Top » Catalog » R1b » Z40246

$18.00

Z40246
[Z40246]

Z40246
hg38 Position: ChrY:17270315..17270315
Ancestral: G
Derived: A
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream Z253 > L1066
Forward Primer: Z40246_F AGTGATTATTGATGATTGATGATTGATC
Reverse Primer: Z40246_R AGGCAAAACCCTGTCTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z18008
$18.00
Haplogroup Info
Other products
Currencies