Top » Catalog » R1b » A647

$18.00

A647
[A647]

A647
hg38 Position: ChrY:7482259..7482259
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A647_F GGAAAGGGCACTTACCCAAC
Reverse Primer: A647_R TCTGCCATTGAAAGTATCAGACAC
Reviews

Customers who bought this product also purchased
A646
A646
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A479
$18.00
Haplogroup Info
Other products
Currencies