Top » Catalog » R1b » A649

$18.00

A649
[A649]

A649
hg38 Position: ChrY:8722844..8722844
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A649_F CCTCTCACAGGTGTATATCAGGTTC
Reverse Primer: A649_R TCATCTGTGTGGCCTTTGC
Reviews

Customers who bought this product also purchased
A653
A653
A658
A658
A656
A656
A655
A655
A654
A654
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A994
$18.00
Haplogroup Info
Other products
Currencies