Top » Catalog » R1b » A654

$18.00

A654
[A654]

A654
hg38 Position: ChrY:15477869..15477869
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A654_F CAATAAGTTAAGATCTTCCTGGCC
Reverse Primer: A654_R TGAAGATACAAACACACACATCTCC
Reviews

Customers who bought this product also purchased
A658
A658
A656
A656
A655
A655
A653
A653
A649
A649
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies