Top » Catalog » R1b » A655

$19.00

A655
[A655]

A655
hg38 Position: ChrY:17158399..17158399
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A655_F GGACATCCTTTGTGAAATCAGTG
Reverse Primer: A655_R AAATCACATGTGCTAGGCACC
Reviews

Customers who bought this product also purchased
BY5719
BY5719
BY152300
BY152300
BY153784
BY153784
BY20443
BY20443
S268
S268
Z381
Z381
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies