Top » Catalog » R1b » A655

$18.00

A655
[A655]

A655
hg38 Position: ChrY:17158399..17158399
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A655_F GGACATCCTTTGTGAAATCAGTG
Reverse Primer: A655_R AAATCACATGTGCTAGGCACC
Reviews

Customers who bought this product also purchased
U106
U106
FGC18850
FGC18850
P312
P312
S511
S511
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
S268
S268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2203
1 x A8
1 x A364
1 x A2209
1 x A1241
1 x A226
1 x A259
1 x A667
1 x A673
1 x A2240
1 x A1316
1 x A1310
1 x A178
1 x A1129
$252.00
Haplogroup Info
Other products
Currencies