Top » Catalog » R1b » A656

$18.00

A656
[A656]

A656
hg38 Position: ChrY:19624008..19624008
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A656_F CCAGACAAATGAAAGCTGAGG
Reverse Primer: A656_R GCATAAACAATCATGCAAAAAGTAG
Reviews

Customers who bought this product also purchased
A5870
A5870
DF98
DF98
BY5719
BY5719
Z301
Z301
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
BY5716
BY5716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies