Top » Catalog » R1b » A661

$19.00

A661
[A661]

A661
hg38 Position: ChrY:15450728..15450728
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4a
Comments: Downstream of A151
Forward Primer: A661_F TCCCTTGCATTTCATTTGTTC
Reverse Primer: A661_R GATTGGTTGTCCACTACAGCTG
Reviews

Customers who bought this product also purchased
A12087
A12087
A9865
A9865
A12018
A12018
FGC27968
FGC27968
Z255
Z255
A743
A743
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies