Top » Catalog » R1b » A661

$18.00

A661
[A661]

A661
hg38 Position: ChrY:15450728..15450728
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4a
Comments: Downstream of A151
Forward Primer: A661_F TCCCTTGCATTTCATTTGTTC
Reverse Primer: A661_R GATTGGTTGTCCACTACAGCTG
Reviews

Customers who bought this product also purchased
A12018
A12018
FGC27968
FGC27968
A12087
A12087
A9865
A9865
FGC5494
FGC5494
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2191
$18.00
Haplogroup Info
Other products
Currencies