Top » Catalog » R1b » A663

$18.00

A663
[A663]

A663
hg38 Position: ChrY:8985115..8985115
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1c
Comments: Downstream of CTS4466
Forward Primer: A663_F ATGAGGAACCAATCGACCAC
Reverse Primer: A663_R TGCATGAAATAACTCCATAATTAACG
Reviews

Customers who bought this product also purchased
A7699
A7699
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
S1115
S1115
DF41
DF41
A6527
A6527
FGC11134
FGC11134
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies