Top » Catalog » R1b » A663

$18.00

A663
[A663]

A663
hg38 Position: ChrY:8985115..8985115
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1c
Comments: Downstream of CTS4466
Forward Primer: A663_F ATGAGGAACCAATCGACCAC
Reverse Primer: A663_R TGCATGAAATAACTCCATAATTAACG
Reviews

Customers who bought this product also purchased
A6525
A6525
DF13
DF13
A7699
A7699
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
S1115
S1115
DF41
DF41
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2142
1 x A1314
1 x A164
1 x A1308
1 x A985
1 x A759
1 x A350
1 x A1742
1 x A251
1 x A911
1 x A642
1 x A1539
1 x A1011
1 x A426
1 x A525
1 x A809
1 x A1072
1 x A1142
1 x A571
1 x A1079
1 x A1774
1 x A1274
1 x A726
1 x A932
$432.00
Haplogroup Info
Other products
Currencies