Top » Catalog » R1b » A664

$18.00

A664
[A664]

A664
hg38 Position: ChrY:19452263..19452263
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1b3a1
Comments: Downstream of A159
Forward Primer: A664_F CTAGCTTTCTCATACTTTGTGCTTG
Reverse Primer: A664_R GATGTTAGAAACAAGTGCTTGACC
Reviews

Customers who bought this product also purchased
A6508
A6508
A9005
A9005
A541
A541
S1115
S1115
A150
A150
BY2880
BY2880
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A128
1 x A2164
1 x A1017
1 x A1301
1 x A1101
1 x A1315
1 x A1202
1 x A1286
1 x A473
1 x A233
1 x A822
1 x A89
1 x A1053
1 x A2124
1 x A341
1 x A148
1 x A716
1 x A287
1 x A1052
1 x A526
1 x A519
1 x A979
1 x A2237
$414.00
Haplogroup Info
Other products
Currencies