Top » Catalog » R1b » A667

$18.00

A667
[A667]

A667
hg38 Position: ChrY:8510135..8510135
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A667_F CTGTGTTTCATGTTCTCCCAAAG
Reverse Primer: A667_R CACATATTTGTACATTTGATCAAGGAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A669
A669
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies