Top » Catalog » R1b » A1716

$18.00

A1716
[A1716]

A1716
hg38 Position: ChrY:15376312..15376312
Ancestral: C
Derived: T
Reference: Terry Barton (2015)
ISOGG Haplogroup: R1b1a2a1a2b1b (not listed)
Comments: Approximately L196
Forward Primer: A1716_F GGTCAAGATGACTTCCACAAAC
Reverse Primer: A1716_R GCAATGTTGGATGTGATGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2076
$18.00
Haplogroup Info
Other products
Currencies