Top » Catalog » R1b » A662

$18.00

A662
[A662]

A662
hg38 Position: ChrY:16052428..16052428
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a4a1
Comments: Downstream of A151 > A661; aka BY142
Forward Primer: A662_F GAGTTAAAGGATGAGGAGATCACAG
Reverse Primer: A662_R TGCAGTCATGAGATGGTTAACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A390
1 x A569
1 x A2217
1 x A610
1 x A1743
1 x A895
1 x A61
1 x A532
1 x A1256
1 x A444
1 x A861
1 x A1497
$216.00
Haplogroup Info
Other products
Currencies