Top » Catalog » R1b » A669

$18.00

A669
[A669]

A669
hg38 Position: ChrY:20587358..20587358
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A669_F CCAGGCAGGTCTACTTTCAATC
Reverse Primer: A669_R GGTCAAACACTGCAATTCAAAAC
Reviews

Customers who bought this product also purchased
A667
A667
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies