Top » Catalog » R1b » A585

$18.00

A585
[A585]

A585
hg38 Position: ChrY:8312775..8312775
Ancestral: C
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30 > BY11424. Z2-
Forward Primer: A585_F AGGCATTGTGGCTTACAGTTAAG
Reverse Primer: A585_R TGACATGACTTCAGCACTAGGG
Reviews

Customers who bought this product also purchased
A593
A593
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
A592
A592
A599
A599
A591
A591
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies