Top » Catalog » R1b » A585

$18.00

A585
[A585]

A585
hg38 Position: ChrY:8312775..8312775
Ancestral: C
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30 > BY11424. Z2-
Forward Primer: A585_F AGGCATTGTGGCTTACAGTTAAG
Reverse Primer: A585_R TGACATGACTTCAGCACTAGGG
Reviews

Customers who bought this product also purchased
A590
A590
A596
A596
A589
A589
A594
A594
A588
A588
A593
A593
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2231
$18.00
Haplogroup Info
Other products
Currencies