Top » Catalog » R1b » A588

$18.00

A588
[A588]

A588
hg38 Position: ChrY:12038485..12038485
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A588_F GACAAAAGAAAGAGCAAATTCCTG
Reverse Primer: A588_R CTCAGATTTCTGTTTCTCTTTGGTAAG
Reviews

Customers who bought this product also purchased
A596
A596
A589
A589
A594
A594
A585
A585
A593
A593
A586
A586
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies