Top » Catalog » R1b » A589

$18.00

A589
[A589]

A589
hg38 Position: ChrY:13737775..13737775
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A589_F CAACTGAACCTCCCCTATGTG
Reverse Primer: A589_R TAAGGCAAAGCGGTACACG
Reviews

Customers who bought this product also purchased
A591
A591
A597
A597
A590
A590
A596
A596
A588
A588
A594
A594
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A247
1 x A315
1 x A1504
1 x A353
1 x A593
1 x A172
1 x A730
$126.00
Haplogroup Info
Other products
Currencies