Top » Catalog » R1b » A590

$18.00

A590
[A590]

A590
hg38 Position: ChrY:14363972..14363972
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A590_F GCTAAGGAGCCCTTGTAGCAG
Reverse Primer: A590_R TTCCACTTCTCCCTCCCTTC
Reviews

Customers who bought this product also purchased
A599
A599
A591
A591
A597
A597
A589
A589
A596
A596
A588
A588
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2210
1 x A974
1 x A555
1 x A1190
1 x A136
1 x A176
1 x A664
1 x A99
1 x A349
1 x A1000
1 x A1334
1 x A354
1 x A718
1 x A1075
1 x A422
1 x A998
1 x A928
1 x A1025
$324.00
Haplogroup Info
Other products
Currencies