Top » Catalog » R1b » A591

$18.00

A591
[A591]

A591
hg38 Position: ChrY:16534994..16534994
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A591_F TCAGCATTAAACCTTTGAGCAC
Reverse Primer: A591_R AAATGAAAAACCAGGTCCCAG
Reviews

Customers who bought this product also purchased
A594
A594
A585
A585
A593
A593
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
A592
A592
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A732
1 x A638
1 x A687
1 x A312
$72.00
Haplogroup Info
Other products
Currencies