Top » Catalog » R1b » A591

$18.00

A591
[A591]

A591
hg38 Position: ChrY:16534994..16534994
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A591_F TCAGCATTAAACCTTTGAGCAC
Reverse Primer: A591_R AAATGAAAAACCAGGTCCCAG
Reviews

Customers who bought this product also purchased
A592
A592
A599
A599
A590
A590
A597
A597
A589
A589
A596
A596
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies