Top » Catalog » R1b » A591

$18.00

A591
[A591]

A591
hg38 Position: ChrY:16534994..16534994
Ancestral: A
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A591_F TCAGCATTAAACCTTTGAGCAC
Reverse Primer: A591_R AAATGAAAAACCAGGTCCCAG
Reviews

Customers who bought this product also purchased
R1b-Z30 downstream
R1b-Z30 downstream
A592
A592
A599
A599
A590
A590
A597
A597
A589
A589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A514
1 x A699
1 x A445
1 x A1192
1 x A899
1 x A44
$108.00
Haplogroup Info
Other products
Currencies