Top » Catalog » R1b » A592

$18.00

A592
[A592]

A592
hg38 Position: ChrY:16979292..16979292
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A592_F GTCTTGAGGAGGATGTTGTATGG
Reverse Primer: A592_R CTTGCCAGAAATGTGAAATGATAC
Reviews

Customers who bought this product also purchased
A594
A594
A585
A585
A593
A593
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
A591
A591
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A980
1 x A530
1 x A274
1 x A1263
1 x A883
1 x A275
1 x A252
1 x A598
1 x A511
1 x A2157
1 x A60
1 x A260
1 x A318
1 x A612
1 x A1073
1 x A2245
1 x A851
$306.00
Haplogroup Info
Other products
Currencies