Top » Catalog » R1b » A593

$18.00

A593
[A593]

A593
hg38 Position: ChrY:18997426..18997426
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A593_F AAGGAATTGTTTCTCAACCTGG
Reverse Primer: A593_R TGCAGAAGAATGCATCCAAAC
Reviews

Customers who bought this product also purchased
A597
A597
A589
A589
A596
A596
A588
A588
A594
A594
A585
A585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A892
1 x A1066
$36.00
Haplogroup Info
Other products
Currencies